Skip to main content
Menu
Revvity logo
Contact us
  • Request a quote
  • Contact sales
  • Contact customer care
  • Application support
  • Instrument service request
  • Training request
US
Search all
  • Who we serve
    • Academia
      Explore BioLegend

      Learn about our world class antibodies for a diverse set of research areas including immunology, neuroscience, cancer, stem cells and cell biology.

      Visit BioLegend.com

    • Pharma / Biotech
      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Clinical Laboratories
      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Healthcare Professionals
      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Contract Research Organizations
      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    10% OFF sample prep instruments, accessories, and consumables!

    Terms and conditions apply.

    Learn more

  • Products
    • Research & Development
      • Genomic Analysis
        • IncRNA in Functional Studies
        • Nucleic Acid Isolation
        • NGS Workflows
        • Microplate Readers
        • Microfluidic Nucleic Acid Analysis
        • CRISPR Technologies
        • RNA Interference
        • Transfection and Ancillary Reagents
        • Oligonucleotide Custom Synthesis
        • cDNAs and ORF Clones
        • Single-Cell Sequencing
        • Labeled Nucleotides
        • qPCR
        • Library Prep Kits
        • Magnetic Beads
        • Viral Vector Products
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Protein Analysis
        • Binding Assays
        • Immunoassays
        • Microfluidic Protein Characterization
        • Microplate Readers
        • Microplates
        • Recombinant Proteins
        • Western Blotting
        • Sample Dissociation
        • M-PVA Magnetic Beads
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Cell Analysis
        • Cell Isolation
        • Cell Lines & Stem Cells
        • Cell Counting and Image Cytometry
        • Cell Health & Viability
        • Cellular Imaging & Analysis
        • Immunoassays
        • In Vivo Imaging
        • Microplates
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Research Solutions
        • Immunoassays Solutions
        • pHSense Reagents
        • Biomarker Discovery
        • Cell and Gene Therapy
        • GMP Workflows
        • Biologics
        • Small Molecule Drug Discovery
        • Disease Research
        • Target Class
        • Drug Development
        • Precision Medicine Research
        • Functional Genomic Screening Solutions
        • Assay Development Workflows
        • Physiological Model Solutions
        • Biobanking Workflows
        • Agrigenomics Workflows
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Clinical & Diagnostics
      • Reproductive Health
        • Maternal and Prenatal Testing
        • Newborn Screening
        • Newborn Sequencing Research
        • Pregnancy-Relevant Infections
        • Endocrine Reproductive
        • Cell-free DNA Analysis
        • Neonatal Research
        • Preimplantation Genetic Testing
        • PlGF Testing Research
        • Molecular Cytogenetics
        New IVD Mimix™ reference standards for oncology workflows.

        Learn more

      • Infectious Diseases
        • Tuberculosis Management
        • EUROIMMUN Solutions
        • IDS Solutions
        • Nucleic Acid Isolation for Pathogen Detection
        • Cytomegalovirus
        • SARS-COV-2 Testing Solutions
        • Bacterial & Viral Nucleic Acid Isolation
        • Metagenomics
        New IVD Mimix™ reference standards for oncology workflows.

        Learn more

      • Cancer
        • ASR Flow Cytometry Antibodies
        • HPV Testing
        • ctDNA Workflows
        • miRNA-seq Analysis
        • Exosome/cfRNA Analysis
        • Targeted Sequencing
        • Mimix Reference Standards
        • Functional Testing
        NEW! Mimix IVD reference standards

        Providing diagnostic labs with trusted quality controls for developing tests and monitoring workflows, with the added assurance of IVD marking. Explore our newest MimixTM controls.

        Learn more

      • Autoimmunity
        • EUROIMMUN Solutions
        • IDS Solutions
        New IVD Mimix™ reference standards for oncology workflows.

        Learn more

      • Endocrinology
        New IVD Mimix™ reference standards for oncology workflows.

        Learn more

      • Allergy
        New IVD Mimix™ reference standards for oncology workflows.

        Learn more

      • Neurodegeneration
        • Alzheimer's Disease
        • Amytrophic Lateral Sclerosis (ALS)
        • Neurogranin
        • BACE1
        New IVD Mimix™ reference standards for oncology workflows.

        Learn more

      • Rapid Patient Testing
        New IVD Mimix™ reference standards for oncology workflows.

        Learn more

      New IVD Mimix™ reference standards for oncology workflows.

      Learn more

    • Reagents
      • BioLegend
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Cellular Imaging Reagents
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • chemagic Nucleic Acid Purification Kits
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • CRISPR Technologies
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • GPCR Research Reagents
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Immunoassays
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • In Vivo Imaging Reagents
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Liquid Scintillation Cocktails
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • NGS Library Prep Kits
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • pHSense Reagents
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • qPCR
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Radiochemicals
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • RNA Interference
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Primary and Secondary Antibodies
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Platforms & Automation
      • Nucleic Acid Purification
        • chemagic Applications
        • chemagic IVD Instruments
        • chemagic IVD Kits
        • chemagic Instruments
        • chemagic Kits
        • M-PVA Magnetic Beads
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Automated Liquid Handling
        • Flow Cytometry Cocktail Prep Automation
        • Liquid Handling Workstations
        • Automated Liquid Handling Applications
        • Liquid Handling Consumables & Accessories
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Integrated Lab Automation
        • Automated Plate Loading
        • Workstation Modules
        • Scheduling & Control Software
        • Robotics
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Microfluidic Analysis
        • Microfluidic Protein Characterization
        • Microfluidic Nucleic Acid Analysis
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Detection Solutions
        • Plate Reader Accessories
        • Microplate Readers
        • Radiometric Detectors
        • Radiochemicals
        • Liquid Scintillation Cocktails
        • Radiometric Consumables & Accessories
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Imaging
        • Cellular Imaging & Analysis
        • In Vivo Imaging
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Cell Counting and Image Cytometry
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Sample Homogenization
        • Homogenizers
        • Homogenizer Accessories
        • Homogenizer Consumables
        • Sample Centrifugation
        • Sample Sonication
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • In Vitro Diagnostics (IVD) Platforms & Automation
        • IVD Nucleic Acid Isolation
        • IVD Automated Liquid Handling
        • IVD Radiometric Detectors
        • EUROIMMUN Instruments
        • IDS Instruments
        • Clinical Applications
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Consumables & Accessories
        • Cassettes
        • Cell Harvesters
        • In Vivo Imaging Accessories
        • High-Content Imaging Accessories
        • Microplates
        • Radioactive Spill Cleaners
        • Scintillation Cocktails
        • Transfer Membranes
        • Charcoal Traps
        • Homogenizer Accessories
        • Homogenizer Consumables
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      • Instrument Service & Maintenance
        • On Demand Equipment Service
        • Equipment Service Plans
        New! Cellometer™ Ascend™

        Explore our cell counting and image cytometry solutions.

        Learn more

      New! Cellometer™ Ascend™

      Explore our cell counting and image cytometry solutions.

      Learn more

    • Consumables & Accessories
      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Signals Software
      • All Products
        • Signals One
        • ChemDraw
        • Spotfire®
        • Signals Clinical
        • Signals Notebook
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • All Solutions
        • Biology
        • Discovery Chemistry
        • Clinical & Translational
        • Specialty Chemicals
        • Food/Flavor/Fragrance
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Revvity Omics Services
      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    10% OFF sample prep instruments, accessories, and consumables!

    Terms and conditions apply.

    Learn more

  • Services
    • Preclinical Services
      • Antibody Drug Conjugate Services
        Preclinical services

        Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

        Learn more

      • Complex Cell Model Screening Services
        Preclinical services

        Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

        Learn more

      • Base Editing Platform
        • Pin-point base editing platform cell line engineering services
        • Pin-point base editing platform pooled tiled screening services
        Preclinical services

        Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

        Learn more

      • Immune Cell Screening
        Preclinical services

        Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

        Learn more

      • Functional Genomic Screening Services
        Preclinical services

        Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

        Learn more

      • Cell Panel Screening
        Preclinical services

        Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

        Learn more

      • Cell Line Engineering
        • CHOSOURCE CLE Services
        Preclinical services

        Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

        Learn more

      • Viral Vector Engineering and Manufacture
        Preclinical services

        Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

        Learn more

      Preclinical services

      Work with our experienced scientific team and leverage our advanced technologies to help accelerate the preclinical drug discovery process.

      Learn more

    • Revvity Omics Services
      • Revvity Omics Clinical Services
        • Cytogenomics
        • Global Laboratory Network
        • Metabolic Testing
        • Newborn Screening Services
        • Prenatal Screening Services
        • Proactive Testing
        • Rare Disease Testing
        • Specialized and Customized Assays
        • Sponsored Testing Programs
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Revvity Omics Pharma Services
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      T-SPOT.TB testing services.

      Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

      Learn more

    • Clinical & Testing Services
      • Revvity Omics Clinical Services
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Revvity Omics Pharma Services
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Cellular and Humoral Immunoassays
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Tuberculosis Testing Services
        • Oxford Diagnostic Laboratories Service Closures
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      T-SPOT.TB testing services.

      Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

      Learn more

    • Customization Services
      • Assays and Reagents
        • Assay Development
        • Compound profiling
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Microplate Services
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Custom Conjugation & Labeling
        • Custom Labeling
        • Small Molecule
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Radiosynthesis and Labeling
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      T-SPOT.TB testing services.

      Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

      Learn more

    • Licensing
      • Gene Delivery Licensing
        CHOSOURCE expression platform

        Revvity's expression platform provides an enhanced system for the development and manufacturing of biotherapeutics that can be used in commercial manufacturing applications.

        Learn more

      • Gene Expression Systems
        • CHOSOURCE Platform
        CHOSOURCE expression platform

        Revvity's expression platform provides an enhanced system for the development and manufacturing of biotherapeutics that can be used in commercial manufacturing applications.

        Learn more

      • Pin-point™ Base Editing Platform
        CHOSOURCE expression platform

        Revvity's expression platform provides an enhanced system for the development and manufacturing of biotherapeutics that can be used in commercial manufacturing applications.

        Learn more

      • Virus Screening
        CHOSOURCE expression platform

        Revvity's expression platform provides an enhanced system for the development and manufacturing of biotherapeutics that can be used in commercial manufacturing applications.

        Learn more

      CHOSOURCE expression platform

      Revvity's expression platform provides an enhanced system for the development and manufacturing of biotherapeutics that can be used in commercial manufacturing applications.

      Learn more

    • Viral Vector Engineering and Manufacture
      • AAV Services
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Lentivirus Services
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      T-SPOT.TB testing services.

      Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

      Learn more

    • Instrument Service & Maintenance
      • AV Services
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • Equipment Service Plans
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      • On-demand Equipment Service
        T-SPOT.TB testing services.

        Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

        Learn more

      T-SPOT.TB testing services.

      Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

      Learn more

    • Customer Training
      T-SPOT.TB testing services.

      Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

      Learn more

    • OEM Solutions
      T-SPOT.TB testing services.

      Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

      Learn more

    T-SPOT.TB testing services.

    Revvity's Oxford Diagnostic Laboratories is a large referral laboratory for tuberculosis testing services based on our T-SPOT technology.

    Learn more

  • Company
    • Purpose
      • Approach
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Our Story
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Leadership
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Careers
      • Careers Home
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Why Revvity
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Search Jobs
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • Investor Relations
      • Events
        Investor Day 2024

        Driving meaningful innovation that profoundly impacts science and human lives.

        Learn more

      • Financials
        Investor Day 2024

        Driving meaningful innovation that profoundly impacts science and human lives.

        Learn more

      • Stock Info
        Investor Day 2024

        Driving meaningful innovation that profoundly impacts science and human lives.

        Learn more

      Investor Day 2024

      Driving meaningful innovation that profoundly impacts science and human lives.

      Learn more

    • ESG
      • Environmental
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Social
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Governance
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    • News
      • Announcements
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Awards
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Media Alerts
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      • Press Coverage
        10% OFF sample prep instruments, accessories, and consumables!

        Terms and conditions apply.

        Learn more

      10% OFF sample prep instruments, accessories, and consumables!

      Terms and conditions apply.

      Learn more

    10% OFF sample prep instruments, accessories, and consumables!

    Terms and conditions apply.

    Learn more

  • Resources
    • Product Support
      • Application Support Knowledge base (ASK)
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • SDS Search
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • COA/TDS Search
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Manual/IFU Search
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • SpectraViewer
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • RAD Calculator
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    • Resource Center
      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    • Blog
      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    • Events
      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    • Customer Training
      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    • Help Center
      • Order Support
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Contact Us
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Technical Support
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Instruments Support & Service
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • SDS Request
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • COA/TDS Request
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Manual/IFU Request
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Training Request
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Cell Line Terms & Conditions
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    • FAQs
      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    • Software Downloads
      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    • Knowledge Base
      • Application support knowledge base (ASK)
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Sample homogenization applications and protocols
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Newborn screening disorders
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • TB testing services
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Investigator led studies
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      • Tuberculosis (TB)
        Tech documents, at your fingertips.

        Quickly find and download manuals, safety documents, certificates of analysis and more.

        Search now

      Tech documents, at your fingertips.

      Quickly find and download manuals, safety documents, certificates of analysis and more.

      Search now

    Tech documents, at your fingertips.

    Quickly find and download manuals, safety documents, certificates of analysis and more.

    Search now

  • Brands
      Revvity Brands
    • BioLegend

    • EUROIMMUN

    • Revvity Omics

    • Revvity Signals

    • Tulip Diagnostics

    • ViaCord

    • Popular Revvity Product Brands
    • AlphaLISA and SureFire Ultra

    • BioQule NGS

    • chemagic

    • EnVision Nexus

    • Fontus

    • HTRF

    • IVIS

    • LEGENDplex

    • Opera Phenix

    • T-SPOT

    • TotalSeq

    • View all Revvity brands
  • Welcome to Revvity: renowned brands and boundless innovation.

    Hearing the word "can't" is our call to action!

    We help scientists, researchers, and clinicians overcome the world's greatest health obstacles.

    View our story

    Featured brand: BioLegend

    Learn about our world-class antibodies for a diverse set of research areas including immunology, neuroscience, cancer, stem cells and cell biology.

    Visit BioLegend.com

Shop
Request a Quote
Contact Us
US
Revvity Sites Globally

Select your location.

*e-commerce not available for this region.

australia.webp Australia
austria.webp Austria
belgium.webp Belgium
brazil.webp Brazil *
canada.webp Canada
china.webp China *
denmark.webp Denmark
finland.webp Finland
france.webp France
germany.webp Germany
hong-kong.webp Hong Kong *
india.webp India *
ireland.webp Ireland
italy.webp Italy
japan.webp Japan *
luxembourg.webp Luxembourg
mexico.webp Mexico *
netherlands.webp Netherlands
norway.webp Norway
philippines.webp Philippines *
republic of korea.webp Republic of Korea *
singapore.webp Singapore *
spain.webp Spain
sweden.webp Sweden
switzerland.webp Switzerland
thailand.webp Thailand *
uk.webp United Kingdom
usa.webp United States
Login/Register here
Revvity web shop online account

Get exclusive pricing on all online purchases.

Login to your Revvity.com account for your account's pricing, easy re-ordering from favorites & order history, priority order processing, and dynamic order tracking.

Login Register
Revvity Omics portal accounts

Initiate a new order or access test status and results for clinical genomics or newborn screening services.

View login options
Breadcrumb
...
  • Home
  • Blog
  • NGS
  • Barcode series: multiplexing with indexes of varying lengths.
1395152 -1920px

Blog

NGS

Mar 15th 2024

2 min read

Barcode series: multiplexing with indexes of varying lengths.

Help us improve your Revvity blog experience!

Feedback

Sample multiplexing, also known as multiplex sequencing, allows libraries to be pooled and sequenced simultaneously during a single run on Illumina® instruments. When you are working with libraries obtained with different library preparation kits, or different vendors, it is not uncommon that libraries will have indexes of different lengths, raising the question of whether it is possible to mix them or not. Pooling libraries with different index lengths in the same NGS run is possible, as long as each sample has a unique i5 and i7 index. If, for example, you are trying to combine a library with 8 nt and another one with 10 nt index, the first 8 nt will have to be unique amongst each of them.

To ensure compatibility of the libraries, you will have to modify the index sequences listed in the sample sheet. Following the previous example, if you are pooling libraries with indexes 10 nt and 8 nt, you should set the index length of the run to 10 nt, and “add” 2 bases to the end of each 8 nt index, so the final length of the indexes of all samples is 10. Depending on the difference between the short and the long library, the number of bases to be added to the short libraries will be different.

1395152 -850px

So, let’s say we want to combine in the same pool our NEXTFLEX™ ultra high-throughput unique dual index barcodes (10 nt) NEXTFLEX Unique Dual Index Barcodes (8NT index, 1-96) Discover  with our NEXTFLEX 384 unique dual index barcode set (8 nt) NEXTFLEX UDI Barcodes (10NT, 1-1,536) Discover . For simplicity we will be focusing on the i7 of the library but same procedure should be carried out for i5.

NEXTFLEX 1536 UDI barcodes (P7 sequence) 

GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG NEXTFLEX® 384 UDI barcodes (P7 sequence) 

GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG
In this case you will have add in the sample sheet 2 nt to the NEXTFLEX® DNA barcodes, to have at the end a length of 8+2 = 10

 

17 Index Index Modified index for sample sheet
Barcode Adapter 1 AATCGTTA AATCGTTAAT
Barcode Adapter 2 GTCTACAT GTCTACATAT
Barcode Adapter 3 CGCTGCTC CGCTGCTCAT
Barcode Adapter 4 GATCAACA GATCAACAAT

 

Since the added bases are the same in all the short libraries, we recommend > 50% of the pool consists of libraries with longest index.  This will ensure there is sufficient base diversity in the last four bases of the index read. If this rule is not followed, the run won’t fail, but the quality of the last bases will drop.

See our complete line of sequence tested NEXTFLEX® NGS barcodes for multiplexing. We have barcodes to meet your needs.

For research use only. Not for use in diagnostic procedures.

Help us improve your Revvity blog experience!

Feedback

Share this post:

  • Email
  • Facebook
  • Linkedin
  • Twitter

More NGS posts

Color balance in Illumina sequencing: why it still matters.
Read
Cell-free DNA: dynamic regulation and NGS strategies for ultra-low-frequency variant detection.
Read
Transfer RNA beyond translation.
Read

Questions?
We’re here to help.

Contact us
Revvity Logo
  • Company
    • Purpose
    • Approach
    • Our Story
    • Leadership
    • Careers
    • News
    • Investor Relations
    • ESG
  • Connect
    • Contact Us
    • Offices & Authorized Distributors
    • Newsletter
    • BioLegend
    • EUROIMMUN
    • Revvity Signals
    • Tulip Diagnostics
    • ViaCord
  • Policies
    • All Policies
    • Privacy Policy
    • Terms & Conditions
    • Cookie Policy
    • Accessibility
  • Support
    • Order Support
    • Technical Support
    • Customer Care
    • Request Service Visit
    • Customer Training
    • Sales
    • Contact Us By Phone
    • FAQs
  • Facebook
    FB
  • Instagram
    IG
  • LinkedIn
    LI
  • Twitter
    X
  • Youtube
    YT

©2025 Revvity - All rights reserved

Revvity is a trademark of Revvity, Inc. All other trademarks are the property of their respective owners.